Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGCTTGTGTGCTGACAGTGTGGT[G/T]AAGGGCCGTCTGCCCCAGCTGGGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607359 MIM: 609722 | ||||||||||||||||||||
Literature Links: |
C8orf58 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C8orf58 - chromosome 8 open reading frame 58 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CCAR2 - cell cycle and apoptosis regulator 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021174.5 | 498 | Silent Mutation | GTG,GTT | V,V 83 | NP_066997.3 | |
XM_011544603.1 | 498 | Silent Mutation | GTG,GTT | V,V 83 | XP_011542905.1 | |
XM_011544604.1 | 498 | Silent Mutation | GTG,GTT | V,V 83 | XP_011542906.1 | |
XM_017013717.1 | 498 | Silent Mutation | GTG,GTT | V,V 83 | XP_016869206.1 |
LOC107986876 - proline-rich proteoglycan 2-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PDLIM2 - PDZ and LIM domain 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |