Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGAGGTCCTGATGGAGAGCCCGCC[A/G]GTGAGTGTGGTTGCGTGTGTGTATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 112264 MIM: 608302 MIM: 178620 | ||||||||||||||||||||
Literature Links: |
BMP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BMP1 - bone morphogenetic protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LGI3 - leucine rich repeat LGI family member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SFTPC - surfactant protein C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001172357.1 | 200 | Silent Mutation | CCA,CCG | P,P 14 | NP_001165828.1 | |
NM_001172410.1 | 200 | Silent Mutation | CCA,CCG | P,P 14 | NP_001165881.1 | |
NM_001317778.1 | 200 | Silent Mutation | CCA,CCG | P,P 14 | NP_001304707.1 | |
NM_001317779.1 | 200 | Silent Mutation | CCA,CCG | P,P 14 | NP_001304708.1 | |
NM_001317780.1 | 200 | Silent Mutation | CCA,CCG | P,P 14 | NP_001304709.1 | |
NM_003018.3 | 200 | Silent Mutation | CCA,CCG | P,P 14 | NP_003009.2 | |
XM_011544613.2 | 200 | Silent Mutation | CCA,CCG | P,P 14 | XP_011542915.1 |