Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTGAGCTGCATATGGTGGAGTGGA[A/G]GACCTGCCTCTCGGTGGCCCCGGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614543 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAM69B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAM69B - family with sequence similarity 69 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152421.3 | 500 | Missense Mutation | AAG,AGG | K,R 92 | NP_689634.2 | |
XM_006716954.3 | 500 | Missense Mutation | AAG,AGG | K,R 95 | XP_006717017.1 | |
XM_011518238.2 | 500 | Missense Mutation | AAG,AGG | K,R 137 | XP_011516540.1 | |
XM_017014273.1 | 500 | Missense Mutation | AAG,AGG | K,R 5 | XP_016869762.1 |
SNHG7 - small nucleolar RNA host gene 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA17A - small nucleolar RNA, H/ACA box 17A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA17B - small nucleolar RNA, H/ACA box 17B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |