Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAACCCCCCTGCCACTCCCGCCCCC[A/G]ATGCAGAGCTTCCAAGGAAACCAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 120930 MIM: 609072 MIM: 612905 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C8G PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C8G - complement component 8, gamma polypeptide | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FBXW5 - F-box and WD repeat domain containing 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LCN12 - lipocalin 12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_178536.3 | 278 | Silent Mutation | CCA,CCG | P,P 30 | NP_848631.2 | |
XM_006717065.3 | 278 | Silent Mutation | CCA,CCG | P,P 30 | XP_006717128.1 | |
XM_011518560.2 | 278 | Silent Mutation | CCA,CCG | P,P 57 | XP_011516862.1 | |
XM_011518561.2 | 278 | Silent Mutation | CCA,CCG | P,P 58 | XP_011516863.2 | |
XM_011518562.2 | 278 | Silent Mutation | CCA,CCG | P,P 30 | XP_011516864.1 | |
XM_017014631.1 | 278 | Silent Mutation | CCA,CCG | P,P 58 | XP_016870120.1 | |
XM_017014632.1 | 278 | Silent Mutation | CCA,CCG | P,P 58 | XP_016870121.1 |