Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCCTTGGGCTCTTCTTTGTTTCTC[C/T]GTATGGGCGCGTTGAGCTCCTCATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605204 MIM: 615143 | ||||||||||||||||||||
Literature Links: |
C9orf78 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C9orf78 - chromosome 9 open reading frame 78 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016520.2 | 782 | Missense Mutation | CAG,CGG | Q,R 237 | NP_057604.1 | |
XM_011518780.2 | 782 | Intron | XP_011517082.1 |
TOR1A - torsin family 1 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP20 - ubiquitin specific peptidase 20 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |