Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTCTCAGCTTCCTCCCTTTTCTTT[C/T]TTCGTTTTGCTTTACTGAAATGACA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600709 MIM: 611534 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
IARS PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
IARS - isoleucyl-tRNA synthetase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3651 - microRNA 3651 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOL8 - nucleolar protein 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256394.1 | 2883 | Missense Mutation | AAA,AGA | K,R 905 | NP_001243323.1 | |
NM_017948.5 | 2883 | Missense Mutation | AAA,AGA | K,R 973 | NP_060418.4 | |
XM_006717166.3 | 2883 | Missense Mutation | AAA,AGA | K,R 973 | XP_006717229.1 | |
XM_006717167.3 | 2883 | Missense Mutation | AAA,AGA | K,R 973 | XP_006717230.1 | |
XM_006717168.3 | 2883 | Missense Mutation | AAA,AGA | K,R 935 | XP_006717231.1 | |
XM_006717169.3 | 2883 | Missense Mutation | AAA,AGA | K,R 905 | XP_006717232.1 | |
XM_006717170.3 | 2883 | Missense Mutation | AAA,AGA | K,R 905 | XP_006717233.1 | |
XM_006717172.3 | 2883 | Missense Mutation | AAA,AGA | K,R 847 | XP_006717235.1 | |
XM_006717173.3 | 2883 | Missense Mutation | AAA,AGA | K,R 847 | XP_006717236.1 | |
XM_011518824.2 | 2883 | Missense Mutation | AAA,AGA | K,R 905 | XP_011517126.1 | |
XM_011518827.2 | 2883 | Missense Mutation | AAA,AGA | K,R 847 | XP_011517129.1 | |
XM_017014876.1 | 2883 | Missense Mutation | AAA,AGA | K,R 935 | XP_016870365.1 | |
XM_017014877.1 | 2883 | Missense Mutation | AAA,AGA | K,R 867 | XP_016870366.1 | |
XM_017014878.1 | 2883 | Missense Mutation | AAA,AGA | K,R 847 | XP_016870367.1 | |
XM_017014879.1 | 2883 | Missense Mutation | AAA,AGA | K,R 847 | XP_016870368.1 | |
XM_017014880.1 | 2883 | Missense Mutation | AAA,AGA | K,R 809 | XP_016870369.1 |
SNORA84 - small nucleolar RNA, H/ACA box 84 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |