Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGAAGCCGGTGGCCTCACTGCCTT[C/T]GTCCTGCCTCCCGAAGCGGAATCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 189980 MIM: 613357 MIM: 609795 | ||||||||||||||||||||
Literature Links: |
ABL1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABL1 - ABL proto-oncogene 1, non-receptor tyrosine kinase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FIBCD1 - fibrinogen C domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
QRFP - pyroglutamylated RFamide peptide | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_198180.2 | 798 | Missense Mutation | AAA,GAA | K,E 93 | NP_937823.1 |