Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGGGGGTCGGGAAAGGCACGCTGA[G/T]GGTGCTGGGGGTCATTCGGTTAAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300060 MIM: 300022 MIM: 312090 MIM: 312070 | ||||||||||||||||||||
Literature Links: |
LAGE3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LAGE3 - L antigen family member 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006014.4 | 535 | Missense Mutation | ATC,CTC | I,L 65 | NP_006005.2 |
PLXNA3 - plexin A3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC10A3 - solute carrier family 10 member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBL4A - ubiquitin like 4A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |