Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGGTGTGATCACAGGTGTGTCTTA[G/T]GCCAGGGCATCAGCTCCCAGCAGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604995 | ||||||||||||||||||||
Literature Links: |
CRIP3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CRIP3 - cysteine rich protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC22A7 - solute carrier family 22 member 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006672.3 | Intron | NP_006663.2 | ||||
NM_153320.2 | Intron | NP_696961.2 | ||||
XM_006714970.3 | Intron | XP_006715033.1 | ||||
XM_006714971.3 | Intron | XP_006715034.1 | ||||
XM_011514256.2 | Intron | XP_011512558.1 | ||||
XM_011514257.2 | Intron | XP_011512559.1 | ||||
XM_011514259.1 | Intron | XP_011512561.1 | ||||
XM_011514261.2 | Intron | XP_011512563.1 | ||||
XM_011514262.2 | Intron | XP_011512564.1 | ||||
XM_011514263.2 | Intron | XP_011512565.1 | ||||
XM_017010198.1 | Intron | XP_016865687.1 | ||||
XM_017010199.1 | Intron | XP_016865688.1 | ||||
XM_017010200.1 | Intron | XP_016865689.1 | ||||
XM_017010201.1 | Intron | XP_016865690.1 |
TTBK1 - tau tubulin kinase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |