Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTCCTCAGAAGCAGCCCCCTGGAG[C/T]GGTTTCTCTTTCTGCTGCTTTTGGA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 300081 MIM: 300394 | |||||||||||||||||||||||
Literature Links: |
CH17-340M24.3 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CH17-340M24.3 - uncharacterized protein BC009467 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DNASE1L1 - deoxyribonuclease I-like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAZ - tafazzin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000116.4 | Intron | NP_000107.1 | ||||
NM_001303465.1 | Intron | NP_001290394.1 | ||||
NM_181311.3 | Intron | NP_851828.1 | ||||
NM_181312.3 | Intron | NP_851829.1 | ||||
NM_181313.3 | Intron | NP_851830.1 | ||||
XM_006724836.1 | Intron | XP_006724899.1 | ||||
XM_006724837.1 | Intron | XP_006724900.1 | ||||
XM_006724839.1 | Intron | XP_006724902.1 | ||||
XM_006724841.3 | Intron | XP_006724904.1 | ||||
XM_006724842.3 | Intron | XP_006724905.1 | ||||
XM_011531189.1 | Intron | XP_011529491.1 | ||||
XM_011531191.2 | Intron | XP_011529493.1 | ||||
XM_017029761.1 | Intron | XP_016885250.1 | ||||
XM_017029762.1 | Intron | XP_016885251.1 | ||||
XM_017029763.1 | Intron | XP_016885252.1 | ||||
XM_017029764.1 | Intron | XP_016885253.1 | ||||
XM_017029765.1 | Intron | XP_016885254.1 |
Set Membership: |
HapMap |