Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAATTATCATTCTTTTCTTGAGTAG[G/T]CTGCTACCCAAAGACTGCTGCACCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608577 MIM: 138319 | ||||||||||||||||||||
Literature Links: |
CHURC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHURC1 - churchill domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CHURC1-FNTB - CHURC1-FNTB readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001202558.1 | Intron | NP_001189487.1 | ||||
NM_001202559.1 | Intron | NP_001189488.1 |
GPX2 - glutathione peroxidase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002083.3 | Intron | NP_002074.2 |
RAB15 - RAB15, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |