Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTATCTTAAACCCTAGATATGAAC[A/C]TGATTCTTCTTACCATTTTTTCCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
13 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607999 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ASH1L PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ASH1L - ASH1 like histone lysine methyltransferase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018489.2 | Intron | NP_060959.2 | ||||
XM_005245337.4 | Intron | XP_005245394.1 | ||||
XM_006711450.3 | Intron | XP_006711513.1 | ||||
XM_006711451.3 | Intron | XP_006711514.1 | ||||
XM_006711452.3 | Intron | XP_006711515.1 | ||||
XM_011509769.2 | Intron | XP_011508071.1 | ||||
XM_011509770.2 | Intron | XP_011508072.1 | ||||
XM_017001784.1 | Intron | XP_016857273.1 | ||||
XM_017001785.1 | Intron | XP_016857274.1 | ||||
XM_017001786.1 | Intron | XP_016857275.1 | ||||
XM_017001787.1 | Intron | XP_016857276.1 | ||||
XM_017001788.1 | Intron | XP_016857277.1 |
MIR555 - microRNA 555 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RUSC1 - RUN and SH3 domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |