Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATTAACTGGAGTGGAGGGCGCTTG[C/T]TTTTGTTTCTAGATGAGTGCTTCCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600007 MIM: 611114 MIM: 180471 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
FLT3LG PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
FLT3LG - fms related tyrosine kinase 3 ligand | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR150 - microRNA 150 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL13A - ribosomal protein L13a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS11 - ribosomal protein S11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001015.4 | Intron | NP_001006.1 |
SNORD32A - small nucleolar RNA, C/D box 32A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD33 - small nucleolar RNA, C/D box 33 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD34 - small nucleolar RNA, C/D box 34 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD35A - small nucleolar RNA, C/D box 35A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD35B - small nucleolar RNA, C/D box 35B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |