Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGGGGACCCCCGCCACTTGGAAC[A/C]GGGTTCTGTCTACCTGTAGACACCT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 603123 MIM: 601916 MIM: 612602 | |||||||||||||||||||||||
Literature Links: |
DCAF1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
DCAF1 - DDB1 and CUL4 associated factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DOCK3 - dedicator of cytokinesis 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MANF - mesencephalic astrocyte derived neurotrophic factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006010.5 | Intron | NP_006001.4 |
RBM15B - RNA binding motif protein 15B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |