Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGGCCCCGGAGGTGGCGCAGCCG[A/G]AAGTTCTTGGGCTTGCTTCCCTGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616787 MIM: 614246 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C16orf90 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C16orf90 - chromosome 16 open reading frame 90 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080524.1 | 237 | Silent Mutation | TTC,TTT | F,F 57 | NP_001073993.1 | |
XM_005255502.3 | 237 | Silent Mutation | TTC,TTT | F,F 72 | XP_005255559.1 |
CLUAP1 - clusterin associated protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015041.2 | 237 | Intron | NP_055856.1 | |||
NM_024793.2 | 237 | Intron | NP_079069.1 | |||
XM_006720867.3 | 237 | Intron | XP_006720930.1 | |||
XM_017023068.1 | 237 | Intron | XP_016878557.1 | |||
XM_017023069.1 | 237 | Intron | XP_016878558.1 | |||
XM_017023070.1 | 237 | Intron | XP_016878559.1 | |||
XM_017023071.1 | 237 | Intron | XP_016878560.1 | |||
XM_017023072.1 | 237 | Intron | XP_016878561.1 | |||
XM_017023073.1 | 237 | Intron | XP_016878562.1 |
MIR6126 - microRNA 6126 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NAA60 - N(alpha)-acetyltransferase 60, NatF catalytic subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |