Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGGCTGAAGGCCGACTGTGATTCC[C/T]CCTACCCCCACAAGGCGATTTTGAC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
17 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603717 MIM: 604013 MIM: 603456 MIM: 610411 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATP6V0B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATP6V0B - ATPase H+ transporting V0 subunit b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
B4GALT2 - beta-1,4-galactosyltransferase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DPH2 - DPH2 homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039589.1 | 85 | UTR 5 | NP_001034678.1 | |||
NM_001319165.1 | 85 | UTR 5 | NP_001306094.1 | |||
NM_001319166.1 | 85 | UTR 5 | NP_001306095.1 | |||
NM_001319167.1 | 85 | UTR 5 | NP_001306096.1 | |||
NM_001319168.1 | 85 | UTR 5 | NP_001306097.1 | |||
NM_001319169.1 | 85 | UTR 5 | NP_001306098.1 | |||
NM_001319170.1 | 85 | UTR 5 | NP_001306099.1 | |||
NM_001319171.1 | 85 | UTR 5 | NP_001306100.1 | |||
NM_001384.4 | 85 | UTR 5 | NP_001375.2 | |||
XM_017000502.1 | 85 | UTR 5 | XP_016855991.1 | |||
XM_017000503.1 | 85 | UTR 5 | XP_016855992.1 | |||
XM_017000504.1 | 85 | UTR 5 | XP_016855993.1 | |||
XM_017000505.1 | 85 | UTR 5 | XP_016855994.1 | |||
XM_017000506.1 | 85 | UTR 5 | XP_016855995.1 |
IPO13 - importin 13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |