Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGTAATGACGGAGCTGCACAGAGA[C/T]GGAGGACACACTGTAGGAGGGAAAC
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610781 MIM: 603171 MIM: 190195 MIM: 604319 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
GMPR2 PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Global
|
Caucasian
|
CEPH (CEU) - Not Available | |||||||||
EAS
|
African American
|
YRI (Yoruba)
|
|||||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||||||||
EUR
|
|||||||||||
AMR
|
GMPR2 - guanosine monophosphate reductase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002000.2 | 1014 | Intron | NP_001002000.1 | |||
NM_001002001.2 | 1014 | Intron | NP_001002001.1 | |||
NM_001002002.2 | 1014 | Intron | NP_001002002.1 | |||
NM_001283021.1 | 1014 | Intron | NP_001269950.1 | |||
NM_001283022.1 | 1014 | Intron | NP_001269951.1 | |||
NM_001283023.1 | 1014 | Intron | NP_001269952.1 | |||
NM_016576.4 | 1014 | Intron | NP_057660.2 | |||
XM_005267740.3 | 1014 | Intron | XP_005267797.1 | |||
XM_005267741.3 | 1014 | Intron | XP_005267798.1 | |||
XM_005267742.3 | 1014 | Intron | XP_005267799.1 | |||
XM_006720165.2 | 1014 | Intron | XP_006720228.1 | |||
XM_017021356.1 | 1014 | Intron | XP_016876845.1 | |||
XM_017021357.1 | 1014 | Intron | XP_016876846.1 | |||
XM_017021358.1 | 1014 | Intron | XP_016876847.1 | |||
XM_017021359.1 | 1014 | Intron | XP_016876848.1 | |||
XM_017021360.1 | 1014 | Intron | XP_016876849.1 |
NEDD8 - neural precursor cell expressed, developmentally down-regulated 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEDD8-MDP1 - NEDD8-MDP1 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TGM1 - transglutaminase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TINF2 - TERF1 interacting nuclear factor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099274.1 | 1014 | Silent Mutation | CCA,CCG | P,P 380 | NP_001092744.1 | |
NM_012461.2 | 1014 | UTR 3 | NP_036593.2 | |||
XM_005267529.3 | 1014 | Silent Mutation | CCA,CCG | P,P 345 | XP_005267586.1 | |
XM_011536642.2 | 1014 | UTR 3 | XP_011534944.1 | |||
XM_017021216.1 | 1014 | Silent Mutation | CCA,CCG | P,P 166 | XP_016876705.1 | |
XM_017021217.1 | 1014 | Silent Mutation | CCA,CCG | P,P 166 | XP_016876706.1 |
Set Membership: |
HapMap Validated |