Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTGGAGGGCCAAAGCCTATAGAG[C/T]TGGGCACTACAGCTGCTCATGCTGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
5 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614264 MIM: 616041 MIM: 191523 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARHGAP30 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ARHGAP30 - Rho GTPase activating protein 30 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001025598.1 | 3224 | UTR 3 | NP_001020769.1 | |||
NM_001287600.1 | 3224 | UTR 3 | NP_001274529.1 | |||
NM_001287602.1 | 3224 | UTR 3 | NP_001274531.1 | |||
NM_181720.2 | 3224 | UTR 3 | NP_859071.2 | |||
XM_005245070.2 | 3224 | UTR 3 | XP_005245127.1 | |||
XM_005245073.3 | 3224 | UTR 3 | XP_005245130.1 | |||
XM_011509391.2 | 3224 | UTR 3 | XP_011507693.1 | |||
XM_017000960.1 | 3224 | UTR 3 | XP_016856449.1 |
TSTD1 - thiosulfate sulfurtransferase like domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USF1 - upstream transcription factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |