Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCCTGAGCATCCCCATCCCCTCTC[G/T]CAACTTACTGTGTTCAGCCCTCCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
20 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600339 MIM: 611930 MIM: 611836 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
HDGF PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
HDGF - hepatoma-derived growth factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ISG20L2 - interferon stimulated exonuclease gene 20 like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPL24 - mitochondrial ribosomal protein L24 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024540.3 | Intron | NP_078816.2 | ||||
NM_145729.2 | Intron | NP_663781.1 | ||||
XM_011509981.2 | Intron | XP_011508283.1 | ||||
XM_011509982.2 | Intron | XP_011508284.1 |
RRNAD1 - ribosomal RNA adenine dimethylase domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |