Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGGCAGGCTACAGTCCCAAACCC[C/T]GCTAGGACCTCTAGTCAAGCAGACA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605077 MIM: 609917 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DMAP1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DMAP1 - DNA methyltransferase 1 associated protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001034023.1 | Intron | NP_001029195.1 | ||||
NM_001034024.1 | Intron | NP_001029196.1 | ||||
NM_019100.4 | Intron | NP_061973.1 | ||||
XM_005271037.4 | Intron | XP_005271094.1 | ||||
XM_005271039.1 | Intron | XP_005271096.1 | ||||
XM_005271040.1 | Intron | XP_005271097.1 | ||||
XM_006710771.3 | Intron | XP_006710834.1 | ||||
XM_011541784.2 | Intron | XP_011540086.1 | ||||
XM_011541785.2 | Intron | XP_011540087.1 | ||||
XM_017001807.1 | Intron | XP_016857296.1 | ||||
XM_017001808.1 | Intron | XP_016857297.1 |
ERI3 - ERI1 exoribonuclease family member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ERI3-IT1 - ERI3 intronic transcript 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |