Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCTTTAGCACTGCCTTCTTTTTCT[C/T]CACTCCACAGGGAGTTGGTCCCAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
9 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605548 MIM: 601380 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ADAM15 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ADAM15 - ADAM metallopeptidase domain 15 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001261464.1 | Intron | NP_001248393.1 | ||||
NM_001261465.1 | Intron | NP_001248394.1 | ||||
NM_001261466.1 | Intron | NP_001248395.1 | ||||
NM_003815.4 | Intron | NP_003806.3 | ||||
NM_207191.2 | Intron | NP_997074.1 | ||||
NM_207194.2 | Intron | NP_997077.1 | ||||
NM_207195.2 | Intron | NP_997078.1 | ||||
NM_207196.2 | Intron | NP_997079.1 | ||||
NM_207197.2 | Intron | NP_997080.1 |
DCST1 - DC-STAMP domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EFNA4 - ephrin A4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100505666 - uncharacterized LOC100505666 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |