Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGTTTCCCTTGGTCCCATCCCTTA[A/T]TTCTGTGCAGTTCTGGTAATAGGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606670 MIM: 607524 MIM: 607525 MIM: 615714 | ||||||||||||||||||||
Literature Links: |
PPP1R11 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PPP1R11 - protein phosphatase 1 regulatory inhibitor subunit 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF39 - ring finger protein 39 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNRD1 - zinc ribbon domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001278785.1 | Intron | NP_001265714.1 | ||||
NM_001278786.1 | Intron | NP_001265715.1 | ||||
NM_014596.5 | Intron | NP_055411.1 | ||||
NM_170783.3 | Intron | NP_740753.1 |
ZNRD1ASP - zinc ribbon domain containing 1 antisense, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |