Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACGAGACTGAGGAACAGAAGGGCTG[C/T]GTTGGCAAATCACTCACCTGAAACA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
14 submissions
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610393 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
GON4L PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese)
|
||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
GON4L - gon-4 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001282856.1 | Intron | NP_001269785.1 | ||||
NM_001282858.1 | Intron | NP_001269787.1 | ||||
NM_001282860.1 | Intron | NP_001269789.1 | ||||
NM_001282861.1 | Intron | NP_001269790.1 | ||||
NM_032292.5 | Intron | NP_115668.4 | ||||
XM_005245284.3 | Intron | XP_005245341.1 | ||||
XM_005245286.3 | Intron | XP_005245343.1 | ||||
XM_006711393.3 | Intron | XP_006711456.1 | ||||
XM_006711394.3 | Intron | XP_006711457.1 | ||||
XM_011509658.2 | Intron | XP_011507960.1 | ||||
XM_011509659.2 | Intron | XP_011507961.1 |
LOC100505728 - uncharacterized LOC100505728 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MSTO2P - misato family member 2, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap JSNP |