Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGCAAGGCAGGAGTCTGGCAGTA[C/G]CCTGAGTCATGGCTCTGACCCCAGC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 606991 | |||||||||||||||||||||||
Literature Links: |
CDHR4 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CDHR4 - cadherin related family member 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007540.3 | Intron | NP_001007541.2 | ||||
XM_011533700.2 | Intron | XP_011532002.1 | ||||
XM_011533701.2 | Intron | XP_011532003.1 | ||||
XM_017006366.1 | Intron | XP_016861855.1 | ||||
XM_017006367.1 | Intron | XP_016861856.1 | ||||
XM_017006368.1 | Intron | XP_016861857.1 | ||||
XM_017006369.1 | Intron | XP_016861858.1 | ||||
XM_017006370.1 | Intron | XP_016861859.1 | ||||
XM_017006371.1 | Intron | XP_016861860.1 |
FAM212A - family with sequence similarity 212 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IP6K1 - inositol hexakisphosphate kinase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |