Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACTGCCTTAAAATCTGCTTGACTG[C/G]TTTTTCACCAAACTGATGCTTTAAA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 608750 MIM: 608721 MIM: 610145 | |||||||||||||||||||||||
Literature Links: |
ALG3 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ALG3 - ALG3, alpha-1,3- mannosyltransferase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001006941.2 | Intron | NP_001006942.1 | ||||
NM_005787.5 | Intron | NP_005778.1 |
CAMK2N2 - calcium/calmodulin dependent protein kinase II inhibitor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ECE2 - endothelin converting enzyme 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001037324.2 | Intron | NP_001032401.1 | ||||
NM_001100120.1 | Intron | NP_001093590.1 | ||||
NM_001100121.1 | Intron | NP_001093591.1 | ||||
NM_014693.3 | Intron | NP_055508.3 | ||||
NM_032331.3 | Intron | NP_115707.2 |
VWA5B2 - von Willebrand factor A domain containing 5B2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |