Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGCAATACTATGGGGCCTGGGGT[A/G]CGCTGGCCTTTAGTGAGTGGAGTGG
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615357 MIM: 608348 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATP5SL PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese)
|
||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
ATP5SL - ATP5S like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001167867.1 | 1039 | UTR 3 | NP_001161339.1 | |||
NM_001167868.1 | 1039 | UTR 3 | NP_001161340.1 | |||
NM_001167869.1 | 1039 | UTR 3 | NP_001161341.1 | |||
NM_001167870.1 | 1039 | UTR 3 | NP_001161342.1 | |||
NM_001167871.1 | 1039 | UTR 3 | NP_001161343.1 | |||
NM_001320838.1 | 1039 | UTR 3 | NP_001307767.1 | |||
NM_001320839.1 | 1039 | Intron | NP_001307768.1 | |||
NM_001320840.1 | 1039 | UTR 3 | NP_001307769.1 | |||
NM_001320841.1 | 1039 | UTR 3 | NP_001307770.1 | |||
NM_001320844.1 | 1039 | Intron | NP_001307773.1 | |||
NM_018035.2 | 1039 | UTR 3 | NP_060505.2 | |||
XM_011527065.2 | 1039 | UTR 3 | XP_011525367.1 |
B3GNT8 - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BCKDHA - branched chain keto acid dehydrogenase E1, alpha polypeptide | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |