Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCTTAACATAACTAACATACATAA[A/C]TCTAGTTTGAGATAGTCTCGCTCAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613499 MIM: 609904 MIM: 182308 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
HIST1H2AA PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese)
|
||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
HIST1H2AA - histone cluster 1, H2aa | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_170745.3 | Intron | NP_734466.1 |
HIST1H2APS1 - histone cluster 1, H2a, pseudogene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H2BA - histone cluster 1, H2ba | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC17A1 - solute carrier family 17 member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005074.3 | Intron | NP_005065.2 | ||||
XM_011514818.2 | Intron | XP_011513120.2 | ||||
XM_011514819.2 | Intron | XP_011513121.2 | ||||
XM_011514820.2 | Intron | XP_011513122.2 | ||||
XM_011514821.2 | Intron | XP_011513123.1 | ||||
XM_017011199.1 | Intron | XP_016866688.1 | ||||
XM_017011200.1 | Intron | XP_016866689.1 | ||||
XM_017011201.1 | Intron | XP_016866690.1 | ||||
XM_017011202.1 | Intron | XP_016866691.1 |
Set Membership: |
HapMap |