Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAGTCTAGTCTTTGACTCAGCATG[C/T]TTCTTTTTCCATTTTCCTCCATGTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
6 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 608271 | ||||||||||||||||||||
Literature Links: |
BMP8A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BMP8A - bone morphogenetic protein 8a | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_181809.3 | Intron | NP_861525.2 | ||||
XM_006710616.3 | Intron | XP_006710679.1 | ||||
XM_011541381.2 | Intron | XP_011539683.1 | ||||
XM_011541382.2 | Intron | XP_011539684.1 | ||||
XM_017001198.1 | Intron | XP_016856687.1 |
LOC105378950 - mitogen-activated protein kinase 7-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MACF1 - microtubule-actin crosslinking factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |