Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCCCAACTACTTGCACTGCCTATC[C/T]TGATTTCTTTTTCTCTATAGTATTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614109 MIM: 613901 | ||||||||||||||||||||
Literature Links: |
BPIFC PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BPIFC - BPI fold containing family C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_174932.2 | Intron | NP_777592.1 | ||||
XM_011530088.2 | Intron | XP_011528390.1 | ||||
XM_011530089.1 | Intron | XP_011528391.1 | ||||
XM_011530090.1 | Intron | XP_011528392.1 | ||||
XM_011530091.2 | Intron | XP_011528393.1 | ||||
XM_017028740.1 | Intron | XP_016884229.1 |
RTCB - RNA 2',3'-cyclic phosphate and 5'-OH ligase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |