Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTATGACAGCTGAAGATGTTGAACC[C/G]TATGGTGCAGTTTTGCAAATAGTGT
Species: |
Human | ||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||
Phenotype: |
MIM: 606876 | ||||||||||||||||||||||||||
Literature Links: |
MIR3199-1 PubMed Links | ||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
MIR3199-1 - microRNA 3199-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3199-2 - microRNA 3199-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PITPNB - phosphatidylinositol transfer protein beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTC28-AS1 - TTC28 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |