Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAAGCATGCAGGCCAGCTAGGCTCT[C/T]ACAGGCTGGCCAGTCCATCAAGGAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611800 MIM: 612053 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LINC01126 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
LINC01126 - long intergenic non-protein coding RNA 1126 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
THADA - THADA, armadillo repeat containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001083953.1 | Intron | NP_001077422.1 | ||||
NM_001271643.1 | Intron | NP_001258572.1 | ||||
NM_001271644.1 | Intron | NP_001258573.1 | ||||
NM_022065.4 | Intron | NP_071348.3 | ||||
XM_006712061.3 | Intron | XP_006712124.1 | ||||
XM_006712062.1 | Intron | XP_006712125.1 | ||||
XM_006712063.1 | Intron | XP_006712126.1 | ||||
XM_006712064.2 | Intron | XP_006712127.1 | ||||
XM_006712065.1 | Intron | XP_006712128.1 | ||||
XM_006712066.1 | Intron | XP_006712129.1 | ||||
XM_006712067.1 | Intron | XP_006712130.1 | ||||
XM_006712068.3 | Intron | XP_006712131.1 | ||||
XM_006712069.3 | Intron | XP_006712132.1 | ||||
XM_011533015.2 | Intron | XP_011531317.1 | ||||
XM_017004674.1 | Intron | XP_016860163.1 | ||||
XM_017004675.1 | Intron | XP_016860164.1 |
ZFP36L2 - ZFP36 ring finger protein like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |