Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAAACAAGAGTTATGCAGCAATTG[A/T]TAGGGAAGCCTATAGATAATCTAAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601387 MIM: 610985 | ||||||||||||||||||||
Literature Links: |
TSG101 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
TSG101 - tumor susceptibility 101 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UEVLD - UEV and lactate/malate dehyrogenase domains | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040697.2 | Intron | NP_001035787.1 | ||||
NM_001261382.1 | Intron | NP_001248311.1 | ||||
NM_001261383.1 | Intron | NP_001248312.1 | ||||
NM_001261384.1 | Intron | NP_001248313.1 | ||||
NM_001261385.1 | Intron | NP_001248314.1 | ||||
NM_001261386.1 | Intron | NP_001248315.1 | ||||
NM_001297771.1 | Intron | NP_001284700.1 | ||||
NM_018314.4 | Intron | NP_060784.3 | ||||
XM_006718255.2 | Intron | XP_006718318.1 | ||||
XM_011520201.2 | Intron | XP_011518503.1 | ||||
XM_017017985.1 | Intron | XP_016873474.1 | ||||
XM_017017986.1 | Intron | XP_016873475.1 |