Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGCTGGAGTGGAGAAAGCAGTACC[A/G]GAATGTTTTAGAAGCAGGACCAGAT
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602121 MIM: 606288 MIM: 606297 MIM: 606298 MIM: 603059 MIM: 606289 MIM: 606290 MIM: 606291 MIM: 606292 MIM: 606293 MIM: 606294 MIM: 606295 MIM: 606296 MIM: 606299 MIM: 606300 MIM: 606301 MIM: 603058 MIM: 606302 MIM: 606303 MIM: 606304 MIM: 603627 MIM: 606305 MIM: 606306 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
DIAPH1 PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
DIAPH1 - diaphanous related formin 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001079812.2 | Intron | NP_001073280.1 | ||||
NM_001314007.1 | Intron | NP_001300936.1 | ||||
NM_005219.4 | Intron | NP_005210.3 | ||||
XM_011537572.2 | Intron | XP_011535874.1 | ||||
XM_011537573.2 | Intron | XP_011535875.1 |
PCDHGA1 - protocadherin gamma subfamily A, 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGA10 - protocadherin gamma subfamily A, 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGA11 - protocadherin gamma subfamily A, 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGA12 - protocadherin gamma subfamily A, 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGA2 - protocadherin gamma subfamily A, 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGA3 - protocadherin gamma subfamily A, 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGA4 - protocadherin gamma subfamily A, 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGA5 - protocadherin gamma subfamily A, 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGA6 - protocadherin gamma subfamily A, 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGA7 - protocadherin gamma subfamily A, 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGA8 - protocadherin gamma subfamily A, 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGA9 - protocadherin gamma subfamily A, 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGB1 - protocadherin gamma subfamily B, 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGB2 - protocadherin gamma subfamily B, 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGB3 - protocadherin gamma subfamily B, 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGB4 - protocadherin gamma subfamily B, 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGB5 - protocadherin gamma subfamily B, 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGB6 - protocadherin gamma subfamily B, 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGB7 - protocadherin gamma subfamily B, 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGC3 - protocadherin gamma subfamily C, 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGC4 - protocadherin gamma subfamily C, 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGC5 - protocadherin gamma subfamily C, 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |