Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAGTCTAGTTGTGTTCCACTGTGT[C/T]TTCATTGTCCTGCACACTCATGTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 180465 | ||||||||||||||||||||
Literature Links: |
CCDC84 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC84 - coiled-coil domain containing 84 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_198489.2 | Intron | NP_940891.1 | ||||
XM_011542799.1 | Intron | XP_011541101.1 | ||||
XM_011542800.2 | Intron | XP_011541102.1 | ||||
XM_017017652.1 | Intron | XP_016873141.1 |
RPL23AP64 - ribosomal protein L23a pseudogene 64 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS25 - ribosomal protein S25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |