Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAAAGCAGCTGGGCCAGCCGCACA[C/T]TGAGCGGGGCATACCCACTGTACAC
Species: |
Human | ||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||
Phenotype: |
MIM: 605219 MIM: 610034 | ||||||||||||||||||||||||||
Literature Links: |
DIABLO PubMed Links | ||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
DIABLO - diablo IAP-binding mitochondrial protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101593348 - uncharacterized LOC101593348 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VPS33A - VPS33A, CORVET/HOPS core subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022916.4 | 1600 | Missense Mutation | AAT,AGT | N,S 496 | NP_075067.2 |
Set Membership: |
HapMap |