Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGATGGAGCGATCAGAAGACCAGGG[G/T]AAGGGTGTGGCAGATACTGCCACTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604264 MIM: 606671 | ||||||||||||||||||||
Literature Links: |
CELSR3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CELSR3 - cadherin EGF LAG seven-pass G-type receptor 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CELSR3-AS1 - CELSR3 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NCKIPSD - NCK interacting protein with SH3 domain | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016453.3 | Intron | NP_057537.1 | ||||
NM_184231.2 | Intron | NP_909119.1 | ||||
XM_017006594.1 | Intron | XP_016862083.1 | ||||
XM_017006595.1 | Intron | XP_016862084.1 | ||||
XM_017006596.1 | Intron | XP_016862085.1 | ||||
XM_017006597.1 | Intron | XP_016862086.1 | ||||
XM_017006598.1 | Intron | XP_016862087.1 | ||||
XM_017006599.1 | Intron | XP_016862088.1 | ||||
XM_017006600.1 | Intron | XP_016862089.1 |