Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGGAATTGGCATGATCTGATTTAC[A/G]TATTTAAATGGTAATTCTATCTGGA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612026 MIM: 614596 MIM: 614597 MIM: 614598 MIM: 614599 MIM: 614600 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LARP7 PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
LARP7 - La ribonucleoprotein domain family member 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267039.1 | Intron | NP_001253968.1 | ||||
NM_015454.2 | Intron | NP_056269.1 | ||||
NM_016648.3 | Intron | NP_057732.2 |
MIR302A - microRNA 302a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR302B - microRNA 302b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR302C - microRNA 302c | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR302D - microRNA 302d | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR367 - microRNA 367 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZGRF1 - zinc finger GRF-type containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |