Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGCCAGGGACTAAGAGGTAAGTA[A/G]ACCACGCATGAGAGTTTCAAGGTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
FAM13C PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM13C - family with sequence similarity 13 member C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001971.2 | Intron | NP_001001971.1 | ||||
NM_001143773.1 | Intron | NP_001137245.1 | ||||
NM_001166698.1 | Intron | NP_001160170.1 | ||||
NM_198215.3 | Intron | NP_937858.2 | ||||
XM_005269618.4 | Intron | XP_005269675.2 | ||||
XM_005269619.4 | Intron | XP_005269676.2 | ||||
XM_006717702.3 | Intron | XP_006717765.1 | ||||
XM_006717703.3 | Intron | XP_006717766.1 | ||||
XM_011539490.2 | Intron | XP_011537792.1 | ||||
XM_011539491.2 | Intron | XP_011537793.1 | ||||
XM_017015885.1 | Intron | XP_016871374.1 | ||||
XM_017015886.1 | Intron | XP_016871375.1 | ||||
XM_017015887.1 | Intron | XP_016871376.1 | ||||
XM_017015888.1 | Intron | XP_016871377.1 | ||||
XM_017015889.1 | Intron | XP_016871378.1 | ||||
XM_017015890.1 | Intron | XP_016871379.1 | ||||
XM_017015891.1 | Intron | XP_016871380.1 | ||||
XM_017015892.1 | Intron | XP_016871381.1 | ||||
XM_017015893.1 | Intron | XP_016871382.1 |
PHYHIPL - phytanoyl-CoA 2-hydroxylase interacting protein like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |