Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAACCTCCCAGCGGCCCCGCCCTT[C/G]CCGCCCCACTCATCGAAAAACCTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602641 MIM: 612844 MIM: 602695 MIM: 604472 | ||||||||||||||||||||
Literature Links: |
EIF4A1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EIF4A1 - eukaryotic translation initiation factor 4A1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SENP3 - SUMO1/sentrin/SMT3 specific peptidase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015670.5 | 624 | Missense Mutation | TCC,TGC | S,C 114 | NP_056485.2 |
SENP3-EIF4A1 - SENP3-EIF4A1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFSF12 - tumor necrosis factor superfamily member 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFSF12-TNFSF13 - TNFSF12-TNFSF13 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFSF13 - tumor necrosis factor superfamily member 13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |