Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCTTGGCTCTAATCAGCCCCCTTG[G/T]CCCTCCATTCTCTGCTGTTCCAGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
5 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 158340 MIM: 188062 MIM: 600986 | ||||||||||||||||||||
Literature Links: |
MIR92B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR92B - microRNA 92b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MUC1 - mucin 1, cell surface associated | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018016.2 | Intron | NP_001018016.1 | ||||
NM_001018017.2 | Intron | NP_001018017.1 | ||||
NM_001044390.2 | Intron | NP_001037855.1 | ||||
NM_001044391.2 | Intron | NP_001037856.1 | ||||
NM_001044392.2 | Intron | NP_001037857.1 | ||||
NM_001044393.2 | Intron | NP_001037858.1 | ||||
NM_001204285.1 | Intron | NP_001191214.1 | ||||
NM_001204286.1 | Intron | NP_001191215.1 | ||||
NM_001204287.1 | Intron | NP_001191216.1 | ||||
NM_001204288.1 | Intron | NP_001191217.1 | ||||
NM_001204289.1 | Intron | NP_001191218.1 | ||||
NM_001204290.1 | Intron | NP_001191219.1 | ||||
NM_001204291.1 | Intron | NP_001191220.1 | ||||
NM_001204292.1 | Intron | NP_001191221.1 | ||||
NM_001204293.1 | Intron | NP_001191222.1 | ||||
NM_001204294.1 | Intron | NP_001191223.1 | ||||
NM_001204295.1 | Intron | NP_001191224.1 | ||||
NM_001204296.1 | Intron | NP_001191225.1 | ||||
NM_001204297.1 | Intron | NP_001191226.1 | ||||
NM_002456.5 | Intron | NP_002447.4 |
THBS3 - thrombospondin 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRIM46 - tripartite motif containing 46 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |