Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTTCTGAATGTGTGTCATAATTC[A/C]CCATAAGAAAGGTTATGTATATGTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614140 | ||||||||||||||||||||
Literature Links: |
SPECC1L PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
SPECC1L - sperm antigen with calponin homology and coiled-coil domains 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145468.3 | Intron | NP_001138940.3 | ||||
NM_001254732.2 | Intron | NP_001241661.2 | ||||
NM_001254733.1 | Intron | NP_001241662.1 | ||||
NM_015330.4 | Intron | NP_056145.4 |
SPECC1L-ADORA2A - SPECC1L-ADORA2A readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |