Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGAAGCCCTAACAGCGAAGAGCTG[A/C]TGGAGACAGAGTCAGAGCAGTCAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610047 MIM: 602955 | ||||||||||||||||||||
Literature Links: |
CNPY4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CNPY4 - canopy FGF signaling regulator 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LAMTOR4 - late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MBLAC1 - metallo-beta-lactamase domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_203397.2 | 1299 | UTR 3 | NP_981942.1 | |||
XM_005250250.3 | 1299 | UTR 3 | XP_005250307.1 |
TAF6 - TATA-box binding protein associated factor 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |