Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCTTTCCCACCACCTGTCACCTCA[A/G]ACAGGAGCAGGGACCCTCCTGAGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
16 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 607660 | ||||||||||||||||||||
Literature Links: |
BSDC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BSDC1 - BSD domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001143888.2 | 1393 | Intron | NP_001137360.1 | |||
NM_001143889.2 | 1393 | Intron | NP_001137361.1 | |||
NM_001143890.2 | 1393 | Intron | NP_001137362.1 | |||
NM_001300958.1 | 1393 | Silent Mutation | CTG,TTG | L,L 473 | NP_001287887.1 | |
NM_018045.7 | 1393 | Intron | NP_060515.3 | |||
XM_005270986.4 | 1393 | Silent Mutation | CTG,TTG | L,L 456 | XP_005271043.1 | |
XM_011541677.2 | 1393 | Silent Mutation | CTG,TTG | L,L 461 | XP_011539979.1 |
FAM229A - family with sequence similarity 229 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSSK3 - testis specific serine kinase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |