Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACCCCCAAGCTAGACAGAGCCTAA[A/G]CCTGATCATAGCCCAAAAACACCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 107272 MIM: 601782 | ||||||||||||||||||||
Literature Links: |
CD72 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CD72 - CD72 molecule | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001782.2 | Intron | NP_001773.1 | ||||
XM_006716893.2 | Intron | XP_006716956.1 | ||||
XM_006716894.3 | Intron | XP_006716957.1 | ||||
XM_011518074.2 | Intron | XP_011516376.1 | ||||
XM_017015351.1 | Intron | XP_016870840.1 |
MIR4667 - microRNA 4667 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TESK1 - testis-specific kinase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |