Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGCAACTTAAAATAATTTAAATG[A/C]CAGATATAACTGTCTATAGGTAACT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605796 | ||||||||||||||||||||
Literature Links: |
CCDC186 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC186 - coiled-coil domain containing 186 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR2110 - microRNA 2110 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TDRD1 - tudor domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_198795.1 | Intron | NP_942090.1 | ||||
XM_005269978.2 | Intron | XP_005270035.1 | ||||
XM_005269979.2 | Intron | XP_005270036.1 | ||||
XM_011539959.2 | Intron | XP_011538261.1 | ||||
XM_011539960.2 | Intron | XP_011538262.1 | ||||
XM_011539961.2 | Intron | XP_011538263.1 | ||||
XM_011539962.1 | Intron | XP_011538264.1 | ||||
XM_011539963.1 | Intron | XP_011538265.1 | ||||
XM_011539964.1 | Intron | XP_011538266.1 | ||||
XM_011539966.1 | Intron | XP_011538268.1 | ||||
XM_017016414.1 | Intron | XP_016871903.1 | ||||
XM_017016415.1 | Intron | XP_016871904.1 |