Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGTCAAATCATGCCCAAGTGACAG[C/T]TGCCTTTGAGGAACATAGCCTGTTT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 611806 MIM: 616600 | |||||||||||||||||||||||
Literature Links: |
AS3MT PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
AS3MT - arsenite methyltransferase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020682.3 | Intron | NP_065733.2 |
BORCS7 - BLOC-1 related complex subunit 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BORCS7-ASMT - BORCS7-ASMT readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |