Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAATCTCAGCTGGTGCTGCGCAGAG[A/G]CAGCAGTCAGCGTCTGCCGGTGGCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605673 MIM: 611374 MIM: 611375 | ||||||||||||||||||||
Literature Links: |
BTG4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BTG4 - BTG anti-proliferation factor 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017589.3 | 176 | Intron | NP_060059.1 |
C11orf88 - chromosome 11 open reading frame 88 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001100388.1 | 176 | Missense Mutation | GAC,GGC | D,G 59 | NP_001093858.1 | |
NM_207430.2 | 176 | Missense Mutation | GAC,GGC | D,G 59 | NP_997313.2 |
MIR34B - microRNA 34b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR34C - microRNA 34c | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |