Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATTTTAATTCCAAATGTCTTTTCC[A/C]CCTTATATGCAGTTGTACAGCGTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608489 | ||||||||||||||||||||
Literature Links: |
GATS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GATS - GATS, stromal antigen 3 opposite strand | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GPC2 - glypican 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STAG3 - stromal antigen 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001282716.1 | Intron | NP_001269645.1 | ||||
NM_001282717.1 | Intron | NP_001269646.1 | ||||
NM_001282718.1 | Intron | NP_001269647.1 | ||||
NM_012447.3 | Intron | NP_036579.2 | ||||
XM_011515742.1 | Intron | XP_011514044.1 | ||||
XM_017011683.1 | Intron | XP_016867172.1 | ||||
XM_017011684.1 | Intron | XP_016867173.1 | ||||
XM_017011685.1 | Intron | XP_016867174.1 | ||||
XM_017011686.1 | Intron | XP_016867175.1 | ||||
XM_017011687.1 | Intron | XP_016867176.1 |