Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCGCAGCACTAAGCTGGAGGGGTA[A/T]TGCCCGGGGGAGGGGGGTGGCGGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600570 MIM: 606023 MIM: 600044 | ||||||||||||||||||||
Literature Links: |
CLCN2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CLCN2 - chloride voltage-gated channel 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLR2H - RNA polymerase II subunit H | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001278698.1 | Intron | NP_001265627.1 | ||||
NM_001278699.1 | Intron | NP_001265628.1 | ||||
NM_001278700.1 | Intron | NP_001265629.1 | ||||
NM_001278714.1 | Intron | NP_001265643.1 | ||||
NM_001278715.1 | Intron | NP_001265644.1 | ||||
NM_006232.3 | Intron | NP_006223.2 | ||||
XM_006713666.2 | Intron | XP_006713729.1 | ||||
XM_006713667.2 | Intron | XP_006713730.1 | ||||
XM_006713668.3 | Intron | XP_006713731.1 | ||||
XM_006713670.2 | Intron | XP_006713733.1 | ||||
XM_017006636.1 | Intron | XP_016862125.1 | ||||
XM_017006637.1 | Intron | XP_016862126.1 |
THPO - thrombopoietin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |