Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCAGCTGCCCCTACCACCGGGCAA[G/T]CAGCCTGTGGGTTCCGGAAGTGGCT
Species: |
Human | ||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||
Phenotype: |
MIM: 602539 MIM: 608626 | ||||||||||||||||||||||||||
Literature Links: |
LIMD2 PubMed Links | ||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
LIMD2 - LIM domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC729683 - uncharacterized LOC729683 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAP3K3 - mitogen-activated protein kinase kinase kinase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STRADA - STE20-related kinase adaptor alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001003786.2 | Intron | NP_001003786.1 | ||||
NM_001003787.2 | Intron | NP_001003787.1 | ||||
NM_001003788.2 | Intron | NP_001003788.1 | ||||
NM_001165969.1 | Intron | NP_001159441.1 | ||||
NM_001165970.1 | Intron | NP_001159442.1 | ||||
NM_153335.5 | Intron | NP_699166.2 | ||||
XM_005257797.2 | Intron | XP_005257854.1 | ||||
XM_005257798.2 | Intron | XP_005257855.1 | ||||
XM_005257799.2 | Intron | XP_005257856.1 | ||||
XM_005257800.2 | Intron | XP_005257857.1 | ||||
XM_005257801.4 | Intron | XP_005257858.1 | ||||
XM_005257803.4 | Intron | XP_005257860.1 | ||||
XM_011525466.2 | Intron | XP_011523768.1 | ||||
XM_011525467.2 | Intron | XP_011523769.1 | ||||
XM_017025312.1 | Intron | XP_016880801.1 | ||||
XM_017025313.1 | Intron | XP_016880802.1 | ||||
XM_017025314.1 | Intron | XP_016880803.1 |
Set Membership: |
HapMap |